rniadsharri1 rniadsharri1

01-03-2018
Social Studies

contestada

Which city is CORRECTLY matched with the facility located there during World War II? A) J.A. Jones Shipyard in Brunswick B) Bell Aircraft in Savannah C) Ft. Benning in Marietta D) Camp Gordon in Atlanta

Respuesta :

andriansp andriansp

11-03-2018

I believe the answer is: A.) J.A. Jones Shipyard in Brunswick
J.A. Jones Shipyard in Brunswick Played a very crucial roles in world war II because it manufactured the war ships that united states used during world war II. Even by the time of christmas, workers in J.A. Jones Shipyard in Brunswick volunteered to work back in the factory in order to help the country.

Answer Link

Otras preguntas

Read the following passage written by a teen hero: I want to be a vocal advocate for nature. I reject the idea that I am too young to make a difference. I recen

what does the constitution state about the interaction of the judicial branch and new laws

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The archetypes established in ancient mythology A. explain scientific phenomena. B. capture historical facts. C. provide ideas for improved cultural interac

A hat contains three ping-pong balls numbered 1, 2, and 3. kim draws one from the hat. then, without replacing the first ball, she draws another. what is the sa

I need help on exterior angles!

the spread use of chop sticks into southeast asian countries with the influx of chinese migrants there is an example of which of the following concepts A. Stim

Choose all that apply. Melinda finds that she does not like taking risks with her money. Which of the following would you recommend for her? Collectibles stock

A newly formed country in the Caribbean has no high tariffs, yet other countries find it difficult to trade with the new country because of its requirements for

In the Chinese civil war 1945-1949 support for Mao Zedongs communist forces came primarily from the