solibenmaddie solibenmaddie

02-02-2022
Mathematics

contestada

Given g(x)=−x−2, solve for x when g(x) =0

Respuesta :

viratkumar5426 viratkumar5426

02-02-2022

Answer:

anser is 2x nark me as brainlest please

Answer Link

Аноним Аноним

02-02-2022

g(x)=x-2

Graph attached

g(0)=0-2=-2

Ver imagen Аноним

Answer Link

Otras preguntas

A 2-m3 rigid tank initially contains air at 100 kPa and 22oC. The tank is connected to a supply line through a valve. Air is flowing in the supply line at 600 k

What is the surface area of the rectangular prism ? 15in 5in 4in

Homeschooling my little brother this is so complicated. I was already helped with the 1st one can anyone help me with more. Much appreciated.

Zinc metal reacts with hydrochloric acid to produce hydrogen gas and an aqueous solution of zinc(II) chloride. What is the reducing agent in this reaction?

Tomas and Saturn are partners who share income in the ratio of 3:1. Their capital balances are $80,000 and $120,000, respectively. Income Summary has a credit b

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Here are the scores that Jenna has received on her seven quizzes: 16, 13, 20, 16, 12, 17, 18 What is the variance rounded to the nearest tenth? Enter

Which expression is equivalent to -2 - 7 -2 - (-7) 2 - 7 -2 + (-7) 2+7

volume and formula question! use the image attached below to help me The prism shown has a volume 35cm3 Work out h,the height of the triangular cross section vo

What does it mean if an event has a probability of 1/4?