171067292
171067292 171067292
  • 03-08-2021
  • Mathematics
contestada

PLEaseeee HELP MEEE I beg pleaseee I think I got this wrong please correct me.

PLEaseeee HELP MEEE I beg pleaseee I think I got this wrong please correct me class=

Respuesta :

Аноним Аноним
  • 03-08-2021

Answer:

its 7.2

find the distance using the formula

square root ((y2-y1)^2+(x2-x1)^2)

hope that answers your question.

comment for more explanation

Answer Link
AkaDrego AkaDrego
  • 03-08-2021
The answer is 7.2 that’s the right answer
Answer Link

Otras preguntas

Toco el piano _______________ hace dos meses. desde se les por
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Explain the significance of the phoenix. what, according to granger, makes humans different from the phoenix?
please help if you know, thanks!
what is the answer to #16???? Helpppppp
How did immigration affect immigrants and other americans in the 1900s?
A hexahedron is a prism whose base is a _____. A. equilateral triangle B. square C. circle D. triangle
Which of the following have at least two congruent parallel bases? all that apply. A. Cylinder B. Circle C. Cone D. Cube E. None of these F
(50)points 5 questions
I'm doing C++. When i multiply 200000 by 200000, i get 1345294336. I wrote long long x = 200000 * 200000 cout << x << endl;