shukriibrahim36 shukriibrahim36

03-12-2020
Biology

contestada

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Respuesta :

keyonaaaaa keyonaaaaa

03-12-2020

I don’t feel like answering all that but....
C=G G=C T=A A=U

Answer Link

vicgraisi1220 vicgraisi1220

03-12-2020

C=G A=T dont know the rest have a gcodocododd dday

Answer Link

Otras preguntas

According to Adam Smith, why were mercantilist policies that limited trade unwise?

Write a program that reads a list of integers, and outputs those integers in reverse. The input begins with an integer indicating the number of integers that fo

On Mar 3, Lyons Company paid dividends of $1,000. Use your knowledge of what a correct journal entry should look like to identify what would be include

Methanoic acid is the simplest carboxylic acid molecule. It has one carbon atom. Draw the structural model for methanoic acid (using C and H).

HELPPP PLSSSSMylo is tracking the amount of calories he is consuming each day, along with his amount of exercise. He also takes his basal metabolic rate into co

Find the area of the following figure with the indicated dimensions.use pi.

Does anybody know the answer to this ?

Which of these shareholder-employees seems to be receiving reasonable compensation from the S corporation? Ashlynn is the only shareholder-employee of an S cor

Johnny asks you to guess the specific coins he has in his pocket if he has $3.70 in change. You say you need a little more information, to guess. So he tells yo

Brinker accepts all major bank credit cards, including First Savings Bank's, which assesses a 5% charge on sales for using its card. On May 26, Brinker had $6,2