nico298 nico298

02-01-2020
Biology

contestada

PLEASE HELP!!!!!
mitosis is a process by which...

a. dna is replicated
b. cytokinesis occurs
c. cells grow in size
d. a cells nucleus divides

Respuesta :

rachelllanes18 rachelllanes18

02-01-2020

d. a cell nucleus divides

Answer Link

alirae2006 alirae2006

02-01-2020

Answer: d a cells nucleus divides

Explanation:

Answer Link

Otras preguntas

Which of the following is a monomial A. 12c B. C^2 -16 C. c^2+c+6 D. C^3 +4c^2 -12c + 7

Your religious identity is only important for you within your family and does not matter in the public sphere.

Two boys on bicycles start cycling from the same place at the same time. one cyclist travels 15 miles per hour, the other travels 12 miles per hour, if they tra

FIRST ONE TO ANSWER CORRECT GETS BRAINLYIST! Which characteristics of Dickinson’s style are evident in "The Snow”? Check all that apply. - four-line stanzas -

PLEASE HELP ASAP simplify (3x^2 - 3 + 9x^3) - (4x^3 - 2x^2 + 16).x^3 - 5x^2 + 25-x^3 + x^2 + 255x^3 + 2x + 13 5x^3 + 5x^2 - 19

paul has a standard deck of cards. what is the probability he will choose a 2?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Jacky spent 53% of all her money to buy a computer game. How much did the game cost, if Jacky had $120 before buying the game?

hich of the following sentences is correct? A. Seven thousands of people showed up for the concert. B. Does anyone know why Steve ordered five dozens of eggs? C

Tick the option that shows how the words 'where my nan lives' are used in the sentence. On holiday, we drove through the village where my nan lives. 1)as a rela